analytical standard is one of those subjects where the details matter more than the headlines. This page pulls together the background, the mechanisms, and the practical points readers ask about most.
Last reviewed on 2026-08-01. Where a claim depends on a specific study, the study is described rather than over-claimed.
SR9009 is a synthetic small molecule studied as an agonist of REV-ERB nuclear receptors. REV-ERB alpha and REV-ERB beta help regulate circadian rhythms and metabolic gene expression. In laboratory research, SR9009 has been used to probe how these receptors affect skeletal muscle, liver, and adipose tissue. The compound was identified in academic drug-discovery work and is often described in scientific literature by its chemical name and research code. It is not an approved medicine, and human clinical data remain limited or absent.
SR9009 binds REV-ERB receptors and alters their repressive activity on target genes. This action can change transcription of genes involved in lipid handling, glucose metabolism, and mitochondrial function. In rodent studies, treated animals have shown changes in muscle oxidative capacity and exercise performance, though effects vary by dose, duration, and model. The precise molecular steps connecting receptor binding to whole-body outcomes are still an active area of investigation. Findings in animals do not automatically translate to humans.
Because REV-ERB receptors are core clock components, SR9009 has been examined for effects on daily rhythms as well as metabolism. Research has explored whether the compound can shift or reinforce circadian gene expression in tissues such as liver and muscle. Some studies report improved metabolic markers in obese or diabetic mice, while others show context-dependent responses. Questions remain about which effects are direct, which are secondary to timing, and how they might differ across species.
Mechanistically, SR9009 binds the ligand-binding domain of REV-ERBα/β and enhances recruitment of corepressor complexes. This represses target genes rather than activating them. Because REV-ERB proteins normally compete with ROR proteins at shared response elements, the net effect depends on tissue and timing. Researchers use SR9009 to probe how nuclear receptor signaling links the clock to metabolism, inflammation, and muscle biology. Findings are largely preclinical, and the precise contribution of each receptor subtype remains under study.
SR9009 is frequently discussed in fitness and research-chemical contexts, yet it has no approved medical indication. Regulatory agencies have not authorized it for human use, and it is not a standard prescription drug. Some sports organizations list it as a prohibited substance because of its potential performance-enhancing properties. Published human data are sparse, so claims about its effects in people often rely on animal models or anecdotal reports. Quality and identity of online materials can vary widely.
SR9009 is a synthetic small molecule studied as a REV-ERB agonist. REV-ERBα and REV-ERBβ are nuclear receptors that help regulate circadian rhythms and metabolic gene expression. The compound was identified in academic screening efforts to find synthetic ligands for these receptors. In cell and animal studies, SR9009 alters transcription of genes involved in lipid and glucose metabolism, and it can shift circadian behavior. It is not an approved therapeutic agent.
| Property | Value | Notes |
|---|---|---|
| Chemical class | Synthetic REV-ERB agonist | Small-molecule nuclear receptor ligand |
| Appearance | Off-white to pale yellow solid | Typical for research-grade powder |
| Solubility class | Soluble in DMSO; low water solubility | Common stock solutions use organic solvent |
| Typical stock solvent | Dimethyl sulfoxide | Used for laboratory assays |
| Common analytical method | HPLC with UV or mass detection | Used for identity and purity checks |
Regulatory treatment of SR9009 varies by country and region. It is not approved as a pharmaceutical, and several jurisdictions restrict its sale for human consumption. Some authorities classify it as a research chemical, a prescription-only substance, or a prohibited performance-enhancing agent in sport. Purchasers may encounter certificates of analysis, but these documents do not guarantee identity, purity, or legality. In research settings, institutional safety reviews and controlled procurement help ensure that materials are handled under appropriate oversight. The absence of harmonized rules means that legal status can change and requires verification.
Analytical identification of SR9009 typically relies on liquid chromatography coupled with tandem mass spectrometry. In biological samples, researchers first separate the compound from matrix components using protein precipitation, liquid-liquid extraction, or solid-phase extraction. High-performance liquid chromatography with ultraviolet detection and nuclear magnetic resonance spectroscopy can support structural confirmation of reference materials. Because SR9009 is a small, relatively lipophilic molecule, reverse-phase columns and acidic mobile phases are common. Laboratories often include isotope-labeled internal standards to improve quantification and to correct for ion suppression.
Stability depends on physical form, temperature, light exposure, and solvent. Solid SR9009 is generally stored cold and dry, with protection from light to limit degradation. Dimethyl sulfoxide stocks are common for laboratory work, but repeated freeze-thaw cycles can reduce compound integrity. Aqueous solutions may be less stable than organic stocks, and the ethyl ester in the structure can be susceptible to hydrolysis under certain conditions. Researchers typically validate storage conditions and recheck purity before quantitative experiments, especially when using archived material.
Handling practices for SR9009 focus on minimizing degradation and contamination. The solid is generally stored desiccated at or below -20 °C, protected from light and moisture. Stock solutions are often prepared in dimethyl sulfoxide or ethanol, then aliquoted to avoid repeated freeze–thaw cycles. Aqueous solubility is low, so formulations for animal studies may require cosolvents or suspending agents. Personnel should follow institutional chemical safety procedures, because toxicological data for humans are incomplete.
Regulatory status varies by country and intended use. Major drug agencies have not granted marketing authorization for SR9009 as a medicine, and it is not listed as a controlled substance in many jurisdictions. It is often sold as a research chemical, a category that may fall outside pharmaceutical manufacturing rules. Buyers should verify local laws and supplier documentation, including certificates of analysis. The lack of standardized quality controls raises concerns about identity, purity, and actual content in products marketed online.
=== Glutathione peroxidase === Glutathione peroxidases (GPx) are enzymes that use glutathione to break down peroxides, protecting the cell from oxidative damage. It is a key part of animal (including human) antioxidant defenses. They are also found in bacteria, plants, and fungi. GPx was the first selenoprotein discovered, with a highly reactive Sec residue at the active site. Comparison of GPx sequences from all these types of life suggest that the ancestral GPx did not contain selenium; instead, acquision of Sec happened early in animal evolution, before the sponges diverged from other animals. Humans have eight Gpx genes, but only five of them contain Sec (GPX1, GPX2, GPX3, GPX4, GPX6). The non-existence of Sec in GPX7 and GPX8 appears to be universal among animals. The loss of Sec (by replacement with Cys) in GPX5 was, however, a relatively recent event that happened after the divergence of humans from rodents. Rodents have independently lost the Sec in Gpx6, but kept it in their version of Gpx5. Human GPX5 and rodent Gpx6 retain vestigial SECIS elements indicative of their past.
The international drug control conventions, also known as the United Nations drug control conventions, are three related, non self-executing treaties that establish an international legal framework for drug control. They serve to maintain a classification system of controlled substances including psychoactive drugs and precursors, to ensure the regulated supply of those substances useful for medical and scientific purposes, and to prevent other uses. Ratification is near universal among UN member countries. The treaties are the Single Convention on Narcotic Drugs (1961; amended in 1972), the Convention on Psychotropic Substances (1971), and the UN Convention Against Illicit Traffic in Narcotic Drugs and Psychotropic Substances (1988). There are also other minor treaties addressing drugs, such as the Convention on the Rights of the Child or the UN Convention on the Law of the Sea.
Atomic nuclei consist of protons and neutrons bound together by the residual strong force. Because protons are positively charged, they repel each other. Neutrons, which are electrically neutral, stabilize the nucleus in two ways. Their copresence pushes protons slightly apart, reducing the electrostatic repulsion between the protons, and they exert an attractive nuclear force on each other and on protons. For this reason, one or more neutrons are necessary for two or more protons to bind into a nucleus. As the number of protons increases, so does the ratio of neutrons to protons necessary to ensure a stable nucleus (see graph at right). For example, although the neutron:proton ratio of 32He is 1:2, the neutron:proton ratio of 23892U is greater than 3:2. A number of lighter elements have stable nuclides with the ratio 1:1 (Z = N). The nuclide 4020Ca (calcium-40) is observationally the heaviest stable nuclide with the same number of neutrons and protons. All stable nuclides heavier than calcium-40 contain more neutrons than protons.
Romergoline (INNTooltip International Nonproprietary Name; developmental code name FCE-23884) is a dopamine receptor modulator of the ergoline family which was under development for the treatment of Parkinson's disease and psychotic disorders but was never marketed. It is closely related to the psychedelic drug LSD in terms of chemical structure, though it is not technically a lysergamide itself as the oxygen atom of LSD's carboxamide moiety has been removed to instead form an aminomethyl moiety.
Sources: en.wikipedia.org
Mechanical properties of cellulose in primary plant cell wall are correlated with growth and expansion of plant cells. Live fluorescence microscopy techniques are promising in investigation of the role of cellulose in growing plant cells.
=== Toxins interacting with proteins === Another non-food protein reaction, urushiol-induced contact dermatitis, originates after contact with poison ivy, eastern poison oak, western poison oak, or poison sumac. Urushiol, which is not itself a protein, acts as a hapten and chemically reacts with, binds to, and changes the shape of integral membrane proteins on exposed skin cells. The immune system does not recognize the affected cells as normal parts of the body, causing a T-cell-mediated immune response. Of these poisonous plants, sumac is the most virulent. The resulting dermatological response to the reaction between urushiol and membrane proteins includes redness, swelling, papules, vesicles, blisters, and streaking. Estimates vary on the fraction of the population that will have an immune system response. Approximately 25% of the population will have a strong allergic response to urushiol. In general, approximately 80–90% of adults will develop a rash if they are exposed to 0.0050 mg (7.7×10−5 gr) of purified urushiol. Some people are so sensitive that a molecular trace on the skin can initiate an allergic reaction.
At the active site, a substrate binds to an enzyme to induce a chemical reaction. Substrates, transition states, and products can bind to the active site, as well as any competitive inhibitors. For example, in the context of protein function, the binding of calcium to troponin in muscle cells can induce a conformational change in troponin. This allows for tropomyosin to expose the actin-myosin binding site to which the myosin head binds to form a cross-bridge and induce a muscle contraction. In the context of the blood, an example of competitive binding is carbon monoxide which competes with oxygen for the active site on heme. Carbon monoxide's high affinity may outcompete oxygen in the presence of low oxygen concentration. In these circumstances, the binding of carbon monoxide induces a conformation change that discourages heme from binding to oxygen, resulting in carbon monoxide poisoning.
=== Audio === Todd played the title character in Bleak December Inc.'s 2016 audio drama adaptation of Bram Stoker's Dracula. Todd was the narrator of the spoken word version of Ice Nine Kills' album The Silver Scream, released on June 29, 2023.
=== Non-flammable electrolyte === In 2023, most commercial Li-ion batteries employed alkylcarbonate solvents to assure the formation solid electrolyte interface on the negative electrode. Since such solvents are readily flammable, there has been active research to replace them with non-flammable solvents or to add fire suppressants. Another source of hazard is hexafluorophosphate anion, which is needed to passivate the negative current collector made of aluminium. Hexafluorophosphate reacts with water and releases volatile and toxic hydrogen fluoride. Several strategies have been explored for developing non-flammable Li-ion battery electrolytes. One approach uses fluorinated (co-)solvents, such as methyl-(2,2,2-trifluoroethyl)-carbonate (FEMC) or methyl-3,3,3-trifluoropropionate (MTFP). Another approach uses fluorinated anions, such as lithium bis(trifluoromethanesulfonyl)imide or lithium difluoro(oxalato)borate in high concentrations.
Sources: en.wikipedia.org
Burger King Corporation (also known as BK) is an American fast food chain of hamburger fast food restaurants, headquartered in Miami-Dade County, Florida. The company was founded on July 23, 1953, as Insta-Burger King, a Jacksonville, Florida–based restaurant chain. After Insta-Burger King ran into financial difficulties, its two Miami-based franchisees David Edgerton (1927–2018) and James McLamore (1926–1996) purchased the company in 1959. Over the next half-century, the company changed hands four times and its third set of owners, a partnership between TPG Capital, Bain Capital, and Goldman Sachs Capital Partners, took it public in 2002. In late 2010, 3G Capital of Brazil acquired a majority stake in the company in a deal valued at US$3.26 billion. The new owners promptly initiated a restructuring of the company to reverse its fortunes. 3G, along with its partner Berkshire Hathaway, eventually merged the company with the Canadian-based coffeehouse chain Tim Hortons under the auspices of a new Canadian-based parent company named Restaurant Brands International.
== Clinical features == The disease caused by infection with this parasite is known as rangeliosis. In Brazil it is also known as nambi-uvú (bleeding ears), peste de sangue (bleeding plague) and febre amarela dos cães (yellow fever of dogs).
=== Polyadenylation === Based on software analysis of the mRNA sequences various polyadenylation patterns could be identified for the transcription variants . TV1 and TV2 share the same pattern located on exon 10 starting at position 1246 resulting in a 32 nucleotide motif (AGUAGAGUCUGCGCUGUGACCUUCUGUUGGGC). TV3 uses a motif on exon 11 at the position 320. The motif is also 32 nucleotides long, but differs from the sequence used by TV1/2 (AGUGGCUUGUUCCACCUCAGCUCCCAUCUAAC). The difference in the polyadenylation sequence results in a variance of the minimum free energy values of the predicted RNA folding structures (-28.70 kcal/mol, TV1 and TV2 and -16.03 kcal/mol, TV3), which could result in different length of the Poly-A tail. Based on the observation that stable secondary structures result in decreased polyadenylation of the specific site, this might indicate that TV1 and TV2 are less polyadenylated in comparison to TV3.
=== Components === 44th Reconnaissance Squadron (Fighter), 1 July 1943 – 15 August 1943 45th Reconnaissance Squadron (Fighter), 1 July 1943 – 11 August 1943 46th Reconnaissance Squadron (Bomber), 1 July 1943 – 15 August 1943 47th Liaison Squadron, 1 July 1943 – 11 August 1943
Sources: en.wikipedia.org
SR9009 is a synthetic research compound that acts on REV-ERB nuclear receptors. It is not approved for human use and is sold only as a research chemical. Its effects have been studied mainly in cells and rodents.
It binds REV-ERB alpha and REV-ERB beta and changes the expression of genes tied to metabolism and circadian rhythm. These changes can affect mitochondria and energy use in animal models. The exact chain from receptor binding to physiological outcome is still being mapped.
No reliable human trials show that SR9009 improves athletic performance. Some rodent studies report endurance changes, but these results are not proof of human benefit. Its use in sport is prohibited, and quality and safety data are lacking.
SR9009 is a synthetic compound investigated as an agonist of the nuclear receptors REV-ERBα and REV-ERBβ. It is used in preclinical research on circadian rhythm and metabolism. It is not an approved drug.